circad | circRNAs associated with diseases

hsa_circRNA_104912/hsa_circ_0088442
Gene	DENND1A	Organism	Human
Genome Locus	chr9:126438998-126641300:-	Build	hg19
Disease	Laryngeal Squamous Cell Cancer	ICD-10	Malignant neoplasm of larynx (C32)
DBLink	Link to database	PMID	27158380
Experimental Method
Sample Type	Tissues	Comparison	Laryngeal Squamous Cell Cancer (LSCC) tissues and adjacent non-tumor tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAACTTCACATTCGTGCTCAC Reverse TCCTGGTCACTGTAGTCCTCC	Statistics	Fold Change : Downregulated,21.97 pvalue : p<0.001
Citation
Xuan, L, Qu, L, Zhou, H, Wang, P, Yu, H, Wu, T, Wang, X, Li, Q, Tian, L, Liu, M, Sun, Y (2016). Circular RNA: a novel biomarker for progressive laryngeal cancer. Am J Transl Res, 8, 2:932-9.