Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_104912/hsa_circ_0088442 | |||
Gene | DENND1A | Organism | Human |
Genome Locus | chr9:126438998-126641300:- | Build | hg19 |
Disease | Laryngeal Squamous Cell Cancer | ICD-10 | Malignant neoplasm of larynx (C32) |
DBLink | Link to database | PMID | 27158380 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Laryngeal Squamous Cell Cancer (LSCC) tissues and adjacent non-tumor tissues |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GAACTTCACATTCGTGCTCAC ReverseTCCTGGTCACTGTAGTCCTCC | Statistics | Fold Change : Downregulated,21.97 pvalue : p<0.001 |
Citation | |||
Xuan, L, Qu, L, Zhou, H, Wang, P, Yu, H, Wu, T, Wang, X, Li, Q, Tian, L, Liu, M, Sun, Y (2016). Circular RNA: a novel biomarker for progressive laryngeal cancer. Am J Transl Res, 8, 2:932-9. |